Skip to main content

Table 1 Polymerase chain reaction primer sequences

From: The extract of concentrated growth factor enhances osteogenic activity of osteoblast through PI3K/AKT pathway and promotes bone regeneration in vivo

Target Primer sequences (5′-3′) Product size (bp)
GAPDH F TTGTCTCCTGCGACTTCAACA 182
R GTGGTCCAGGGTTTCTTACTCC
BMP-2 F TAAGGATTAGCAGGTCTTTG 440
R CACAACCATGTCCTGATAAT
OCN F AGGAGGGCAATAAGGTAGTGAA 165
R TACCATAGATGCGTTTGTAGGC
PI3K F CGGTTTCTCCCTTCTACTTCCTG 83
R GCTCTGCCTCAGCCTTTTATTG
  1. GAPDH Glyceraldehyde-3-phosphate dehydrogenase, BMP-2 Bone morphogenetic protein-2, OCN Osteocalcin, PI3K Phosphoinositide 3-kinase