Skip to main content

Table 1 Primer pairs used in real-time PCR analysis

From: Improved response of human gingival fibroblasts to titanium coated with micro-/nano-structured tantalum

Gene Primers (F = forward, R = reverse) Amplicon
ITGB1 F:TGGAGGAAATGGTGTTTGC 107 bp
R:CGTTGCTGGCTTCACAAGTA
ITGA2 F:GCACCACATTAGCATACAGA 138 bp
R:GGCATCATACAGGAGAGGAA
ITGA5 F:GGCTGTGTATGGGGAGAAGA 200 bp
R:TCACCGCGAAGTAGTCACAG
VCL F:CGAATCCCAACCATAAGCAC 158 bp
R:CGCACAGTCTCCTTCACAGA
FN1 F:GACCGAAATCACAGCCAGTAG 101 bp
R:CATCTCCCTCCTCACTCAGC
COL-1A1 F:AAGACATCCCACCAATCACC 120 bp
R:CGTCATCGCACAACACCTT
GAPDH F:TGTGTCCGTCGTGGATCTGA 150 bp
R:TTGCTGTTGAAGTCGCAGGAG